Gene Editing

Clustered regularly interspaced short palindromic repeats (CRISPR) is quickly becoming the most popular tool in the genome editing arena. CRISPR has been adapted for use in mammalian cells from bacterial anti-bacteriophage immune systems.

The TriLink CRISPR tool kit includes two components: the first is a CRISPR nuclease encoded by a Cas9 or Cas12a mRNA, and the second is a guide RNA. In nature, the Cas9 guide consists of a CRISPR RNA (crRNA), as well as a trans-acting CRISPR RNA (tracrRNA). For simplicity and increased potency, researchers fused these two RNAs into a single RNA of ~100 nucleotides, which they called a single guide RNA (sgRNA). In contrast to Cas9, Cas12a utilizes a single guide RNA of ~42 nucleotides.

When Cas9 or Cas12a mRNA and a sgRNA are co-transfected into cells, the guide strand directs the Cas9 or Cas12a protein to a specific location in the genome, where Cas9 then creates a double stranded break. Cas9 Nickase mRNA encodes Cas9 with a D10A mutation, which causes a single stranded nick instead of a double stranded break. This may result in fewer off-target effects.

Chimeric antigen receptor (CAR) T cells have been used for 30 years as one of the Adoptive T cell therapy (ACT) immunotherapy methods for clinical treatment of hematological cancers. More recently, they have also been applied to solid tumors.

A CAR construct typically has been modified to contain a single chain antibody fragment (scFv) binding domain, a transmembrane domain, and the ability to activate T cells through intracellular signaling domains independent of Major Histocompatibility Complexes (MHCs). The modified T cells express CARs on the cell surface that recognize tumor-associated antigens during treatment.

The source material for most CAR T cells is collected from the patient to be treated (autologous transplant). Harvested cells are expanded and modified to express the CAR. CRISPR is often used to site specifically insert at the TRAC (T-cell receptor α constant) locus, replacing the endogenous T-cell receptor. While autologous transplants avoid rejection and graft-versus-host disease, these cells are often from very ill patients and may thus be less potent than cells harvested from healthy donors. An alternative universal, off-the-shelf solution uses modified cells from healthy, allogeneic donors. This offers a pathway to overcome prohibitive costs, minimize manufacturing complexities, shorten the timeline to treatment, and address patient health and biosafety issues.

However, to prevent rejection of these foreign cells, extensive gene deletions via CRISPR are required. CRISPR-Cas engineering offers next-generation CAR T cell solutions that can silence or disrupt any desired genomic locus, minimize graft-versus-host disease (GvHD) and rejection issues, knock out checkpoint receptors, enhance antitumor responses, and more. Today’s CRISPR-Cas engineered CAR T cells have therapeutic potential in treating infectious disease, autoimmune disease, and promoting transplantation tolerance.

TriLink offers several mRNAs for CRISPR that are unmodified or modified with 5-methoxyuridine (5moU) to reduce innate immune responses. With the help of leading researchers in the field, these have been sequence optimized for optimal expression. TriLink also manufactures zinc-finger nuclease, and Transcription activator-like effector nuclease (TALEN) mRNAs, which are used to produce CAR T-cell therapies. When you are ready to move your research to the clinic, TriLink offers GMP synthesis of guide strands and nuclease mRNAs in our cGMP facility.

Find a Solution

• Gene Editing
• Custom Guide Strands
• Custom mRNA Synthesis
• Therapeutic GMP Manufacturing
• Immunotherapeutics

Site specific recombinases are useful tools for the manipulation of genomes, and for conditionally activating or de-activating gene expression in cells and organisms. Recombinases recognize short target DNA sequences of approximately 30-40 nucleotides, and they catalyze directional DNA exchange reactions. Because the recognition sites are not commonly found in the genomes of higher organisms, they can be used as tools to engineer genomes.However, continued expression of a recombinase in a cell or in vivo can result in toxicity and undesired off-target recombination. For this reason, transient expression from mRNA is an ideal method for recombinase expression.

One of the most commonly used recombinases is Cre recombinase. Our CleanCap^® NLS-Cre Recombinase mRNA is a capped (Cap 1) and polyadenylated messenger RNA, encoding Cre recombinase fused to a nuclear localization sequence (NLS). Cre recombinase is a tyrosine recombinase derived from P1 bacteriophage. Cre catalyzes recombination between two loxP sites, which consist of a 34 base pair recognition site (5' ATAACTTCGTATAGCATACATTATACGAAGTTAT 3'). Cre recombinase has been used extensively to manipulate DNA in plants, bacteria, yeast, and mammals. Depending on the orientation of the loxP sites, Cre can be used to induce DNA cassette exchanges, excisions/insertions, inversions, and translocations.

Applications for NLS-Cre Recombinase mRNA include creation of knock-out or knock-in animals, tissue specific protein expression, and marking studies that report delivery of mRNA to a given cell type. Cre recombinase mRNA is also a useful tool in assessing the efficacy of mRNA delivery in vitro and in vivo.

• Custom mRNA Synthesis

Transcription Activator-like Effector Nucleases (TALENs) have emerged as a more accessible alternative to zinc-finger nucleases (ZFN). Like ZFNs, TALENs utilize a modular DNA binding motif that can be modified to introduce new DNA binding specificities. Unlike ZFNs, TALENs are not as prone to the sequence context effects that tend to complicate the de novo design, making them a more practical tool for the general scientific community. TriLink custom mRNA transcription service includes TALEN mRNA. A TALEN consists of multiple repeat variable di-residues (RVDs), which each specify binding to a single nucleotide. TALEN arrays are made by stringing together RVDs in a specific order to provide specificity and binding affinity to novel DNA sequences. Commonly, engineered TALEN sequences are fused to non-specific cleavage domains, such as FokI. As with ZFNs, TALENs function as pairs bound to adjacent DNA sequences. TriLink offers mRNA expression vectors that are designed to easily accept a TALEN cloned using the Golden Gate method.

• Custom mRNA Synthesis

A transposase is an enzyme that catalyzes the movement of a transposon (a DNA element), from one location in a genome to another, in a very precise manner. Transposons are widespread in the human genome, and may be responsible for the rearrangement of as much as 40% of the genome. Transposases were one of the first available tools for inserting exogenous sequences into target genomes. Typically, a sequence designated for transfer is flanked in a transposon cassette by inverted terminal repeats. When the transposon cassette is co-transfected with a transposase mRNA, the transposase catalyzes the excision of the transposon and its insertion into the cell's chromosome. Two common transposase/transposon systems are Sleeping Beauty and PiggyBac. The Sleeping Beauty transposon integrates into TA sequences in the genome, while PiggyBac inserts into TTAA chromosomal sites.

• Custom mRNA Synthesis